🧬 T-Coffee: Advanced Multiple Sequence Alignment

T-Coffee (Tree-based Consistency Objective Function For alignment Evaluation) is a powerful and highly accurate multiple sequence alignment (MSA) program. It is particularly effective for aligning divergent sequences by using a progressive approach guided by a library of pairwise alignments, making it a robust choice for complex sequence analysis.

❓ What is T-Coffee?

T-Coffee generates multiple sequence alignments by combining information from a library of pairwise alignments. This "consistency-based" approach helps to improve accuracy, especially when dealing with sequences that share low similarity. It can align both protein and nucleic acid sequences.

  • High Accuracy: Known for producing reliable alignments, particularly for challenging datasets.

  • Divergent Sequence Handling: Excels at aligning sequences with low overall similarity.

  • Flexible Input: Supports both protein and nucleic acid sequences.

🎯 Why Use T-Coffee? For Challenging Alignment Scenarios

T-Coffee is an indispensable tool for:

  • 🔍 Aligning Distantly Related Sequences: When standard aligners struggle, T-Coffee's consistency-based approach can provide better results.

  • 🧬 Identifying Subtle Conserved Motifs: Its accuracy helps pinpoint less obvious but functionally important conserved regions.

  • 📊 Protein Family Evolution: Gaining deeper insights into the evolutionary relationships within protein families.

  • 🎯 Structural Homology Modeling: Providing more accurate alignments as a basis for predicting protein structures.

  • 📈 Functional Site Prediction: Improving the prediction of active sites and binding regions by better aligning critical residues.

🧑‍💻 How to Use T-Coffee on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a multiple sequence alignment with T-Coffee:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "T-Coffee").

  2. Click the prominent Use Tool button located next to "T-Coffee."

2️⃣ Input Your Sequences

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your sequences in FASTA format or upload a FASTA file. T-Coffee supports both protein and nucleic acid sequences.

    >seqA
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seqB
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seqC
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My T-Coffee Alignment").

  • 💡 Sequence Type: Select the type of sequence you are submitting:

    • Protein
    • DNA
    • RNA

  • ⚙️ OUTPUT FORMAT (format): Choose the desired output format for your alignment results.

    • clustalw (ClustalW) - Default
    • fasta_aln (Pearson/FASTA)
    • msf (MSF)
    • phylip (PHYLIP)
    • score_html (HTML with scores)

  • 📊 MATRIX (matrix): Select the scoring matrix to use for alignments.

    • none - Default
    • blosum (BLOSUM)
    • pam (PAM)

  • ➡️ ORDER (order): Order of sequences in the output alignment.

    • aligned - Default
    • input

4️⃣ Submit Your Job

  • Once your sequences are entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find your multiple sequence alignment in the chosen output format.
  • Look for conserved regions, gaps, and insertions, which provide insights into functional and evolutionary relationships.
  • If you chose score_html output, you might see color-coded scores indicating alignment quality.
  • ⭐ Tip: T-Coffee is often used when other aligners produce less satisfactory results, particularly for sequences with lower similarity.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy analyzing!