🔍 BLASTX: Nucleotide to Protein BLAST

BLASTX (Basic Local Alignment Search Tool, Nucleotide to Protein) is a fundamental bioinformatics tool used to compare a nucleotide (DNA or RNA) query sequence against a protein sequence database. It translates the nucleotide query in all six possible reading frames and then searches these translated protein sequences against the database.

❓ What is BLASTX?

BLASTX takes a DNA or RNA query sequence and translates it into six different protein sequences (three forward frames and three reverse complement frames). It then uses each of these translated protein sequences to search against a chosen protein sequence database. This is particularly useful for identifying potential protein-coding genes in uncharacterized nucleotide sequences.

  • Nucleotide Query vs. Protein Database: Translates nucleotide query to protein, then searches protein database.
  • Six-Frame Translation: Considers all possible protein products from the nucleotide sequence.
  • Gene Identification: Ideal for finding genes in genomic or cDNA sequences.

🎯 Why Use BLASTX? For Gene Discovery & Annotation

BLASTX is indispensable for:

  • 🔍 Gene Discovery: Identifying potential protein-coding genes in novel DNA or RNA sequences (e.g., ESTs, genomic fragments).
  • 🧬 Functional Annotation: Inferring the function of a gene by finding homologous proteins in databases.
  • 📊 Pseudogene Identification: Helping to distinguish functional genes from non-functional pseudogenes.
  • 🎯 Cross-Species Homology: Finding protein homologs from a nucleotide sequence across different organisms.
  • 📈 Sequence Validation: Confirming the coding potential of a nucleotide sequence.

🧑‍💻 How to Use BLASTX on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a nucleotide to protein BLAST search:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "BLASTX").
  2. Click the prominent Use Tool button located next to "BLASTX."

2️⃣ Input Your Nucleotide Sequence

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your nucleotide (DNA or RNA) sequence(s) in FASTA format or upload a FASTA file.

    >my_dna_query
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide a sequence either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My BLASTX Search").

  • 💡 Sequence Type: (Automatically set to DNA for BLASTX, as it expects nucleotide input).

  • 🗄️ Databases: Select one or more protein databases to search against.

    • Default: uniprotkb_swissprot
    • (Many other options available in the Protein Databases Tree on the form)

  • 📝 INCL. TAXONOMY IDs (taxids): Enter taxonomy IDs separated by commas (e.g., 9606, 10090, 7227).

  • 📝 EXCL. TAXONOMY IDs (negative_taxids): Enter taxonomy IDs separated by commas (e.g., 9606, 10090, 7227).

  • 📊 Matrix (matrix): Select the scoring matrix to use for protein alignments (after translation).

    • BLOSUM62 - Default
    • BLOSUM45, BLOSUM50, BLOSUM80, BLOSUM90
    • PAM30, PAM70, PAM250
    • NONE (M10)

  • ➖ Gap Open (gapopen): The penalty for opening a new gap.

    • Default: 11
    • Options: -1, 0, 1, ..., 25

  • ➖ Gap Extend (gapext): The penalty for extending an existing gap.

    • Default: 1
    • Options: -1, 0, 1, ..., 10

  • 📉 EXP.THR (exp): The Expectation Value (E-value) threshold. Matches with E-values higher than this will not be reported. Lower values are stricter.

    • Default: 10
    • Options: 1e-200, 1e-100, 1e-50, 1e-10, 1e-5, 1e-4, 0.001, 0.01, 0.1, 1.0, 10, 100, 1000, 20, 50

  • 🧹 FILTER (filter): Apply a low-complexity filter.

    • F - Default
    • T

  • 🗑️ DROPOFF (dropoff): Dropoff value for the Gapped BLAST algorithm.

    • Default: 0
    • Options: 2, 4, 6, 8, 10

  • 🔢 SCORES (scores): Maximum number of scores to report.

    • Default: 50
    • Options: 0, 5, 10, 20, 50, 100, 150, 200, 250, 500, 750, 1000

  • ↔️ ALIGNMENTS (alignments): Maximum number of alignments to report.

    • Default: 50
    • Options: 0, 5, 10, 20, 50, 100, 150, 200, 250, 500, 750, 1000

  • 📏 SEQUENCE RANGE (seqrange): Define a specific range within the query sequence to search.

    • Default: START-END (entire sequence)

  • 🔢 HSPS (hsps): Maximum number of High-scoring Segment Pairs (HSPs) to report.

    • Default: 100
    • Input type: Number

  • ↔️ GAPALIGN (gapalign): Perform gapped alignments.

    • true - Default
    • false

  • 👁️ ALIGN VIEWS (align): Choose the format for displaying alignments.

    • 0 (pairwise) - Default
    • 1 (Query-anchored identities), 2 (Query-anchored non-identities), 3 (Flat query-anchored identities), 4 (Flat query-anchored non-identities)
    • 5 (BLASTXML), 6 (Tabular), 7 (Tabular with comment lines), 8 (Text ASN.1), 9 (Binary ASN.1), 10 (Comma-separated values), 11 (BLAST archive format (ASN.1)), 12 (Tabular with comment lines with btop)

  • 📊 COMPOSITION-BASED (compstats): Use composition-based statistics.

    • F - Default
    • D, 1, 2, 3

  • 📏 WORD SIZE (wordsize): The length of the initial exact match (seed) required to initiate an alignment.

    • Default: 6
    • Input type: Number

  • 📚 TRANSLTION TABLE (transltable): Select the genetic code table for translating the query sequence.

    • Default: 1 (Standard SGC0)
    • Options: N/A (-1), 1 (Standard SGC0), 2 (Vertebrate Mitochondrial), 3 (Yeast Mitochondrial), ..., 23 (Thraustochytrium Mitochondrial)

4️⃣ Submit Your Job

  • Once your sequence is entered and parameters are set, click the Submit or Run button.
  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find a summary of your BLASTX search, including a graphical overview of matches, a table of significant alignments, and detailed pairwise alignments.
  • Pay attention to the E-value (Expectation Value) and the specific reading frame from which the best match originated.
  • ⭐ Tip: BLASTX is ideal for finding protein-coding regions in raw DNA sequences, especially when you don't know the exact reading frame.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy BLASTing!