🧬 EMBOSS Cons: Generating Consensus Sequences

EMBOSS Cons is a bioinformatics tool used to create a consensus sequence from a multiple sequence alignment (MSA). A consensus sequence represents the most common residues at each position in the alignment, highlighting conserved regions.

❓ What is EMBOSS Cons?

Cons takes a multiple sequence alignment (either protein or nucleic acid) as input and generates a single consensus sequence. This consensus sequence is derived by identifying the most frequently occurring residue at each position in the alignment, based on a specified threshold.

  • Consensus Generation: Creates a representative sequence from an alignment.

  • Highlight Conservation: Clearly shows conserved and variable positions.

  • Flexible Input: Works with both protein and nucleic acid alignments.

🎯 Why Use Cons? Identify Conserved Regions & Design Primers

EMBOSS Cons is indispensable for:

  • 🔍 Conserved Region Identification: Quickly pinpoint highly conserved amino acids or nucleotides, indicating functionally important regions.

  • 📊 Primer Design: Use consensus sequences to design degenerate primers for PCR amplification of related genes.

  • 🧬 Sequence Family Representation: Create a representative sequence for a protein or gene family.

  • 📈 Downstream Analysis: Provide a simplified sequence for further analysis or database searches.

  • 🎯 Variant Analysis: Understand commonalities and variations within a set of related sequences.

🧑‍💻 How to Use EMBOSS Cons on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to generate a consensus sequence from your alignment:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "EMBOSS Cons").

  2. Click the prominent Use Tool button located next to "EMBOSS Cons."

2️⃣ Input Your Multiple Sequence Alignment

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your multiple sequence alignment (MSA) in FASTA format or upload a FASTA file.

    >seq1
ATGGCCATGGCAC-TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seq2
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seq3
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My Consensus Sequence Job").

  • 💡 Sequence Type: Select the type of sequence you are submitting (Protein or DNA). This choice will affect the available MATRIX options.

  • 🔢 PLURALITY (plurality): Set the minimum percentage of identical residues required at a position for a consensus character to be reported.

    • Default: Based on alignment (e.g., Default (based on alignment))

    • Input type: Number/Text

  • 🔡 SETCASE (setcase): Control the case of the output consensus sequence.

    • Default: Based on alignment (e.g., Default (based on alignment))

    • Input type: Number/Text

  • 💯 IDENTITY (identity): Set the identity threshold for reporting consensus.

    • Default: 1

    • Input type: Number

  • 🏷️ NAME (name): Provide a name for the output consensus sequence.

    • Default: EMBOSS0001

    • Input type: Text

  • 📊 MATRIX (matrix): Select the scoring matrix to use for protein alignments. This option dynamically changes based on your "Sequence Type" selection:

    • If Protein Sequence Type: (e.g., EBLOSUM62, EBLOSUM35, EPAM10, etc.)

    • If DNA Sequence Type: (e.g., EDNAFULL, EDNAMAT)

4️⃣ Submit Your Job

  • Once your alignment is entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find the generated consensus sequence.

  • Review the sequence for highly conserved regions, which are often indicative of functional sites or structural motifs.

  • ⭐ Tip: Compare the consensus sequence back to your original alignment to understand the variability at each position.

🧪 Example Usage

Input Multiple Sequence Alignment (FASTA - Protein Example):

>protein_A
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>protein_B
ATGGCCATGGCAC-TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>protein_C
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG