🧬 Infernal Cmscan: RNA Structure & Family Search

Infernal Cmscan is a bioinformatics tool used to search nucleic acid sequences (typically RNA) against a library of RNA family covariance models (CMs). It's highly sensitive for detecting homologs of structured RNAs, such as tRNAs, rRNAs, and other non-coding RNAs (ncRNAs), even when sequence similarity is low.

❓ What is Infernal Cmscan?

Cmscan is part of the Infernal software suite. It takes a query RNA sequence and scans it against a database of covariance models (CMs), which are statistical models that represent both sequence conservation and secondary structure conservation of an RNA family. This allows cmscan to identify members of known RNA families.

  • RNA Family Detection: Identifies known structured RNA families.
  • Structure-Aware Search: Uses covariance models to account for RNA secondary structure.
  • High Sensitivity: Detects distant homologs of structured RNAs.

🎯 Why Use Infernal Cmscan? For Non-Coding RNA Discovery & Annotation

Infernal Cmscan is indispensable for:

  • 🔍 ncRNA Discovery: Identifying novel non-coding RNA genes in genomic or transcriptomic data.
  • 🧬 RNA Family Annotation: Assigning specific RNA families (e.g., tRNA, rRNA, miRNA precursors) to uncharacterized RNA sequences.
  • 📊 Comparative Genomics: Understanding the distribution and evolution of structured RNA families across different species.
  • 🎯 Functional Inference: Predicting the potential function of an RNA molecule based on its family membership.
  • 📈 Genome Annotation Pipelines: Integrating into pipelines for comprehensive annotation of non-coding regions.

🧑‍💻 How to Use Infernal Cmscan on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to search your RNA sequence against covariance models with Cmscan:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "Infernal Cmscan").
  2. Click the prominent Use Tool button located next to "Infernal Cmscan."

2️⃣ Input Your Nucleic Acid Sequence

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your nucleic acid (RNA) sequence in FASTA format or upload a FASTA file.

    >simple_rna_sequence
GGGCUUGUAGCUCAGUUGGUAGAGCGCAUGCUGUUCGUGCGCCAGUUAUCUGAGUGGC

  • Important: You can provide a sequence either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My RNA Scan Job").

  • 💡 Sequence Type: (Automatically set to RNA, as this tool primarily processes RNA sequences).

  • 📉 THRESHOLD MODEL (thresholdmodel): Select the score threshold model to use for reporting matches.

    • cut_ga (GA - gathering cutoffs) - Default
    • cut_nc (NC - noise cutoffs)
    • cut_tc (TC - trusted cutoffs)

4️⃣ Submit Your Job

  • Once your sequence is entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find a list of identified RNA family matches, including their locations on your sequence, scores, and E-values.
  • Results typically indicate which known RNA families your sequence belongs to, along with statistical significance.
  • ⭐ Tip: Focus on matches with low E-values and high scores, as these represent more significant and reliable predictions of structured RNA family membership.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy RNA analysis!