🧬 Kalign: Fast & Accurate Multiple Sequence Alignment

Kalign is a rapid and accurate multiple sequence alignment (MSA) program designed for both protein and nucleic acid sequences. It excels at handling large datasets efficiently, making it a robust choice for various comparative bioinformatics tasks.

❓ What is Kalign?

Kalign generates high-quality multiple sequence alignments. It uses a fast and iterative algorithm based on the Wu-Manber algorithm for string matching, which allows it to align sequences much quicker than some other methods, especially for large numbers of sequences.

• Speed & Accuracy: Balances rapid execution with reliable alignment quality.

• Protein & Nucleic Acid: Capable of aligning both amino acid and nucleotide sequences.

• Scalability: Efficiently handles datasets ranging from a few to many thousands of sequences.

🎯 Why Use Kalign? Essential for Large-Scale Sequence Analysis

Kalign is an indispensable tool for:

• 🔍 Evolutionary Analysis: Inferring phylogenetic relationships by aligning homologous sequences.

• 🧬 Conserved Motif Discovery: Identifying conserved regions and functional motifs across a protein or gene family.

• 📊 Comparative Genomics/Proteomics: Comparing multiple sequences from different organisms to understand similarities and differences.

• 🎯 Primer Design: Using aligned regions to design specific primers for molecular biology experiments.

• 📈 Structural & Functional Inference: Aiding in the prediction of protein structure and function by aligning with sequences of known characteristics.

🧑‍💻 How to Use Kalign on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a multiple sequence alignment with Kalign:

1️⃣ Navigate to the Tool

1. From the main menu, go to All Tools (or search for "Kalign").

2. Click the prominent Use Tool button located next to "Kalign."

2️⃣ Input Your Sequences

• Locate the input box (large text area) or the "upload a Sequence File" option.

• Paste your sequences in FASTA format or upload a FASTA file. Kalign supports both protein and nucleic acid sequences.

  >seq1
  ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
  >seq2
  ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
  >seq3
  ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
  

• Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

• 📝 Title: Provide a descriptive title for your job (e.g., "My Kalign Alignment").

• 💡 Sequence Type: Select the type of sequence you are submitting:

  • Protein
  • DNA
  • RNA (Note: Kalign primarily supports Protein and DNA; RNA might be handled as DNA depending on the backend.)

• ⚙️ OUTPUT FORMAT (format): Choose the desired output format for your alignment.

  • fasta (Pearson/FASTA)
  • clu (ClustalW) - Default for Protein
  • macsim (MACSIM)

• ➖ GAP OPEN PENALTY (gapopen): The penalty for opening a new gap in the alignment.

  • Default for Protein: 11
  • Default for DNA/RNA: 217.0
  • Input type: Number

• ➖ GAP EXTENSION PENALTY (gapext): The penalty for extending an existing gap.

  • Default for Protein: 4
  • Default for DNA/RNA: 39.4
  • Input type: Number

• ➖ TERMINAL GAP PENALTY (termgap): The penalty for gaps at the ends of sequences.

  • Default for Protein: 2
  • Default for DNA/RNA: 292.6
  • Input type: Number

4️⃣ Submit Your Job

• Once your sequences are entered and parameters are set, click the Submit or Run button.

• Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

• On the results page, you will find your multiple sequence alignment in the chosen output format.
• Review the alignment for conserved regions and gaps, which can indicate functional or structural elements.
• ⭐ Tip: Pay attention to the alignment quality, especially in regions with insertions or deletions, to ensure biological relevance.