📊 EMBOSS Newcpgreport: Detailed CpG Island Reporting

EMBOSS Newcpgreport is a bioinformatics tool that generates a detailed report of CpG islands within a nucleic acid sequence. It provides a more comprehensive textual output compared to Cpgplot, listing the precise coordinates and characteristics of identified CpG islands.

❓ What is EMBOSS Newcpgreport?

Newcpgreport scans a DNA sequence for CpG islands based on specific criteria (window size, minimum length, observed/expected CpG ratio, and minimum G+C percentage). Instead of a plot, it produces a tabular or textual report detailing each identified CpG island, including its start and end positions, length, G+C content, and observed/expected CpG ratio.

  • Detailed Reporting: Provides precise coordinates and characteristics of CpG islands.

  • Textual Output: Generates reports suitable for programmatic parsing or detailed review.

  • Gene Regulation Insights: Helps identify potential promoter regions and regulatory elements.

🎯 Why Use Newcpgreport? For Precise CpG Island Data

EMBOSS Newcpgreport is indispensable for:

  • 🔍 Precise Promoter Mapping: Obtaining exact coordinates of CpG islands for targeted experimental design.

  • 🧬 Gene Annotation: Integrating detailed CpG island information into gene annotation pipelines.

  • 📊 Epigenetic Research: Analyzing the distribution and characteristics of CpG islands for studies on DNA methylation.

  • 📈 Comparative Genomics: Comparing CpG island features across different genomic regions or species in a quantitative manner.

  • 🎯 Regulatory Element Identification: Pinpointing potential regulatory elements based on CpG island presence.

🧑‍💻 How to Use EMBOSS Newcpgreport on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to generate a detailed report of CpG islands from your nucleic acid sequence with Newcpgreport:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "EMBOSS Newcpgreport").

  2. Click the prominent Use Tool button located next to "EMBOSS Newcpgreport."

2️⃣ Input Your Nucleic Acid Sequence

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your nucleic acid (DNA) sequence in FASTA format or upload a FASTA file.

    >my_dna_query
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide a sequence either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My CpG Report Analysis").

  • 📏 WINDOW SIZE (window): Input your own value for the size of the sliding window used for calculating CpG statistics.

    • Default: 100
    • Input type: Number

  • 📏 MINIMUM LENGTH (minlen): Input your own value for the minimum length required for a region to be reported as a CpG island.

    • Default: 200
    • Input type: Number

  • 📏 MINIMUM OBSERVED (minoe): Input your own value for the minimum ratio of observed to expected CpG dinucleotides.

    • Default: 0.6
    • Input type: Number

  • 📏 MINIMUM PERCENTAGE (minpc): Input your own value for the minimum percentage of C+G content required in the region.

    • Default: 50
    • Input type: Number

4️⃣ Submit Your Job

  • Once your sequence is entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find a detailed textual or tabular report listing all identified CpG islands.
  • The report will include coordinates (start, end), length, G+C percentage, and observed/expected CpG ratio for each island.
  • ⭐ Tip: Use this detailed report for downstream computational analysis or for precise targeting of specific genomic regions in experiments.

💬 Need Help?

If you run into issues, please visit our Contact Us page for dedicated support. Happy reporting!