🧬 Clustal Omega: High-Performance Multiple Sequence Alignment

Clustal Omega is a widely used and highly efficient bioinformatics tool for performing multiple sequence alignments (MSAs) of protein and nucleic acid sequences. It's designed to handle very large datasets quickly and accurately.

❓ What is Clustal Omega?

Clustal Omega is a next-generation multiple sequence alignment program from the Clustal family. It uses a new algorithm that significantly improves scalability and speed, making it suitable for aligning hundreds of thousands of sequences.

  • Scalable Alignment: Handles large numbers of sequences efficiently.

  • Protein & Nucleic Acid: Supports alignment of both protein and DNA/RNA sequences.

  • Accuracy: Provides reliable alignments crucial for downstream analyses.

🎯 Why Use Clustal Omega? Essential for Comparative Genomics & Proteomics

Clustal Omega is indispensable for:

  • 🔍 Phylogenetic Analysis: Constructing evolutionary trees to understand relationships between sequences.

  • 🧬 Conserved Region Identification: Discovering highly conserved regions within a protein or gene family, indicating functional importance.

  • 📊 Primer Design: Designing primers for PCR based on aligned sequences.

  • 🎯 Protein Domain Prediction: Inferring functional domains by aligning sequences with known features.

  • 📈 Sequence Comparison: Comparing multiple sequences to identify similarities and differences.

🧑‍💻 How to Use Clustal Omega on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a multiple sequence alignment with Clustal Omega:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "Clustal Omega").

  2. Click the prominent Use Tool button located next to "Clustal Omega."

2️⃣ Input Your Sequences

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your sequences in FASTA format or upload a FASTA file.

    >seq1
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seq2
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seq3
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My Protein Alignment").

  • 💡 Sequence Type: Select the type of sequence you are submitting:

    • Protein

    • DNA

    • RNA

  • ⚙️ OUTPUT FORMAT (outfmt): Choose the format for your alignment results.

    • clustal_num (Clustal format with numbering) - Default

    • fasta

    • embl

    • msf

    • nexus

    • phylip

    • selex

    • stockholm

    • vienna

  • ✂️ DEALIGN INPUT (dealign): Choose whether to dealign input sequences before alignment.

    • true

    • false - Default

  • 🌳 MBED-LIKE CLUSTERING GUIDE-TREE (mbed): Use mBed-like clustering for guide tree construction.

    • true - Default

    • false

  • 🔄 MBED-LIKE CLUSTERING ITERATION (mbediteration): Use mBed-like clustering for iteration.

    • true - Default

    • false

  • 🔢 COMBINED ITERATIONS (iterations): Number of combined iterations.

    • 0 - Default

    • 1, 2, 3, etc.

  • 🌲 MAX GUIDE TREE (gtiterations): Maximum number of guide tree iterations.

    • -1 (Auto) - Default

    • 0, 1, 2, etc.

  • 🤖 MAX HMM ITERATIONS (hmmiterations): Maximum number of HMM iterations.

    • -1 (Auto) - Default

    • 0, 1, 2, etc.

  • ➡️ ORDER (order): Order of sequences in the output.

    • aligned - Default

    • input

  • 📊 DISTANCE MATRIX (dismatout): Output distance matrix.

    • false - Default

    • true

  • 🌳 OUTPUT GUIDE TREE (guidetreeout): Output guide tree.

    • true - Default

    • false

4️⃣ Submit Your Job

  • Once your sequences are entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find your multiple sequence alignment in the chosen output format.

  • Look for conserved residues across all sequences, which often indicate functionally important regions.

  • If you opted for a guide tree, it will show the phylogenetic relationships inferred from the alignment.

  • ⭐ Tip: For large alignments, consider using a dedicated alignment viewer (like Mview, if available on Job Dispatcher) for better visualization.

🧪 Example Usage

Input Sequences (FASTA - Protein Example):

>seq1
PQGGEAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQGGAPQ