🧬 MAFFT: High-Speed Multiple Sequence Alignment

MAFFT (Multiple Alignment using Fast Fourier Transform) is a high-speed multiple sequence alignment program. It is widely recognized for its ability to quickly and accurately align large sets of protein or nucleic acid sequences, making it a popular choice for large-scale phylogenetic and comparative studies.

❓ What is MAFFT?

MAFFT uses an iterative refinement method that combines the Fast Fourier Transform (FFT) for rapid homology searching with progressive alignment. This approach allows it to produce highly accurate alignments, particularly for sequences with large insertions or deletions, while maintaining impressive speed.

  • Fast & Accurate: Balances high speed with high alignment quality.

  • Large Dataset Handling: Efficiently aligns thousands of sequences.

  • Flexible Input: Supports both protein and nucleic acid sequences.

🎯 Why Use MAFFT? Ideal for Diverse Alignment Needs

MAFFT is an indispensable tool for:

  • 🔍 Phylogenetic Tree Construction: Generating robust multiple sequence alignments essential for inferring evolutionary relationships.

  • 🧬 Conserved Region Discovery: Identifying highly conserved domains, motifs, and functional sites across a family of sequences.

  • 📊 Genome & Proteome Comparison: Performing comparative analyses of sequences from different species or strains.

  • 🎯 Primer & Probe Design: Utilizing accurate alignments to design specific primers or probes for molecular biology experiments.

  • 📈 Structural Modeling: Providing reliable alignments as input for protein structure prediction and modeling.

🧑‍💻 How to Use MAFFT on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a multiple sequence alignment with MAFFT:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "MAFFT").

  2. Click the prominent Use Tool button located next to "MAFFT."

2️⃣ Input Your Sequences

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your sequences in FASTA format or upload a FASTA file. MAFFT supports both protein and nucleic acid sequences.

    >seqA
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seqB
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seqC
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My MAFFT Alignment").

  • 💡 Sequence Type: Select the type of sequence you are submitting:

    • Protein
    • DNA
    • RNA

  • ⚙️ OUTPUT FORMAT (format): Choose the desired output format for your alignment.

    • fasta (Pearson/FASTA) - Default
    • clustalw (ClustalW)

  • 📊 MATRIX (PROTEIN ONLY) (matrix): Select the scoring matrix for protein alignments.

    • none - Default
    • bl30 (BLOSUM30)
    • bl45 (BLOSUM45)
    • bl62 (BLOSUM62)
    • bl80 (BLOSUM80)
    • jtt100 (JTT PAM100)
    • jtt200 (JTT PAM200)

  • ➖ GAP OPEN PENALTY (gapopen): The penalty for opening a new gap.

    • Default: 1.53
    • Options: 1.0, 1.1, 1.2, ..., 3.0

  • ➖ GAP EXTENSION PENALTY (gapext): The penalty for extending an existing gap.

    • Default: 0.123
    • Input type: Number

  • ➡️ ORDER (order): Order of sequences in the output alignment.

    • aligned - Default
    • input

  • 🌳 TREE REBUILDING NUMBER (nbtree): Number of times to rebuild the guide tree. Higher values can improve accuracy but increase runtime.

    • Default: 2
    • Options: 0, 1, 2, 5, 10, 20, 50, 80, 100 (long run)

  • 🌲 GUIDE TREE OUTPUT (treeout): Whether to output the guide tree used for alignment.

    • true - Default
    • false

  • 🔁 MAX ITERATE (maxiterate): Maximum number of iterative refinement cycles. Higher values can improve accuracy.

    • Default: 2
    • Options: 0, 1, 2, 5, 10, 20, 50, 80, 100

  • ⚡ PERFORM FFTS (ffts): Fast Fourier Transform strategy.

    • none - Default
    • localpair
    • genafpair
    • globalpair

4️⃣ Submit Your Job

  • Once your sequences are entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find your multiple sequence alignment in the chosen output format.
  • Review the alignment for conserved regions, gaps, and insertions, which provide insights into functional and evolutionary relationships.
  • If you opted for guide tree output, it will show the inferred phylogenetic relationships.
  • ⭐ Tip: For very large alignments, consider using a dedicated alignment viewer (like Mview, if available on Job Dispatcher) for better visualization and analysis.