📊 Mview: Visualizing Multiple Sequence Alignments

Mview is a powerful tool for visualizing and annotating multiple sequence alignments (MSAs) in various formats. It enhances the readability of alignments by applying different coloring schemes, displaying consensus sequences, and integrating additional information, making it easier to interpret complex biological data.

❓ What is Mview?

Mview takes a pre-existing multiple sequence alignment file as input and renders it in an interactive and customizable HTML format. It's not an alignment tool itself, but rather a viewer that helps you explore and understand the output of alignment programs like Clustal Omega, MAFFT, or MUSCLE.

  • Enhanced Visualization: Improves readability of large alignments with coloring and formatting.

  • Customizable Output: Offers various options for how the alignment is displayed.

  • Annotation Integration: Can incorporate additional data to enrich the alignment view.

🎯 Why Use Mview? Interpret Complex Alignments with Ease

Mview is an indispensable tool for:

  • 🔍 Identifying Conserved Regions: Quickly spot highly conserved amino acids or nucleotides, indicating functional or structural importance.

  • 🧬 Understanding Sequence Variability: Visualize patterns of conservation and divergence across a set of sequences.

  • 📊 Presentation & Publication: Generate high-quality, customizable alignment views suitable for reports, presentations, or publications.

  • 🎯 Quality Control: Visually inspect alignments generated by other tools for errors or unexpected patterns.

  • 📈 Collaborative Analysis: Share interactive alignment views with colleagues for discussion and interpretation.

🧑‍💻 How to Use Mview on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to visualize your multiple sequence alignment with Mview:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "Mview").

  2. Click the prominent Use Tool button located next to "Mview."

2️⃣ Input Your Multiple Sequence Alignment

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your multiple sequence alignment (MSA) in a supported format (e.g., FASTA, Clustal, MSF) or upload an alignment file.

    >seq1
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seq2
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>seq3
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My Alignment Visualization").

  • 💡 Sequence Type: Select the type of sequence in your alignment (Protein or DNA/RNA).

  • ➡️ INPUT FORMAT (informat): Select the format of your input alignment file.

    • automatic - Default
    • blast
    • fasta / pearson
    • clustal
    • msf
    • pir
    • hssp

  • ⚙️ OUTPUT FORMAT (outputformat): Choose the desired output format for the visualization.

    • mview - Default
    • pearson
    • msf
    • pir
    • rdb
    • plain

  • 📄 HTML MARKUP (htmlmarkup): Where to place the HTML markup.

    • head - Default
    • body
    • data
    • off

  • 🎨 CSS (css): Include CSS styling in the output.

    • ON - Default
    • OFF

  • 🔢 PCID (pcid): Percentage identity calculation method.

    • aligned - Default
    • hit
    • reference

  • 📏 ALIGNMENT (alignment): Display the alignment.

    • ON - Default
    • OFF

  • 📐 RULER (ruler): Display a ruler above the alignment.

    • ON - Default
    • OFF

  • ↔️ ALIGNMENT WIDTH (width): Number of residues per line in the output.

    • Default: 80
    • Options: 50, 60, 80, 100, 120

  • 🌈 COLORING (coloring): Method for coloring residues.

    • identity - Default
    • any
    • consensus
    • group
    • none (N/A)

  • 🎨 COLOR MAP (colormap): Specific color scheme to use.

    • none (N/A) - Default
    • CCLUSTAL, CLUSTAL, CHARGE, CYS, D1, D2, DC1, GPCR, HXLIN, NARDI, P1, PC1, POLAR1, RED (and more, see form for descriptions)

  • ✅ CONSENSUS (consensus): Display a consensus sequence.

    • ON - Default
    • OFF

  • 🎨 CONCOLOURING (concoloring): Coloring method for the consensus sequence.

    • any - Default
    • identity
    • none (N/A)

  • 📊 GROUPMAP (groupmap): Grouping scheme for consensus.

    • none (N/A) - Default
    • CYS (report conserved cysteines only)
    • D1 (report conserved DNA ring types)
    • P1 (report conserved protein physicochemical classes)

  • 🎨 CONCOLORMAP (concolormap): Color map for the consensus sequence.

    • none (N/A) - Default
    • (Same options as colormap)

  • 📊 CONGROUPMAP (congroupmap): Grouping scheme for consensus coloring.

    • none (N/A) - Default
    • (Same options as groupmap)

  • ➖ CONGAPS (congaps): Include gaps in consensus calculation.

    • ON - Default
    • OFF

4️⃣ Submit Your Job

  • Once your alignment is entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will see your multiple sequence alignment rendered according to your chosen visualization parameters.
  • Use the coloring and consensus features to quickly identify conserved regions, variable sites, and overall patterns in your alignment.
  • ⭐ Tip: Experiment with different coloring schemes and consensus options to highlight various aspects of your alignment.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy visualizing!