⚡️ EMBOSS Transeq

🚀 Getting Started

EMBOSS Transeq is a powerful bioinformatics tool for translating nucleotide sequences (DNA or RNA) into protein sequences. This allows researchers to identify protein-coding regions in genes.

❓ What is EMBOSS Transeq?

Transeq translates nucleotide sequences into amino acid sequences using a selected genetic code.

  • Six-frame translation: Processes all possible reading frames, both forward and reverse.
  • Purpose: Identify possible proteins your DNA or RNA might encode.

🎯 Why Use Transeq?

  • 🔍 Gene Prediction: Find potential open reading frames (ORFs) and predict encoded proteins.
  • 🧬 Sequence Annotation: Confirm protein sequences of known genes.
  • 📂 Database Submission: Prepare translated sequences for protein databases.
  • 🌍 Cross-Species Comparison: Compare translated products across different organisms.

🧑‍💻 How to Use EMBOSS Transeq on Job Dispatcher

1️⃣ Navigate to the Tool

  1. Go to the main menu → All Tools (or search "EMBOSS Transeq")
  2. Click Use Tool for "EMBOSS Transeq".

2️⃣ Input Your Nucleotide Sequence

  • Find the input box (large text area).
  • Paste in your nucleotide sequence in FASTA format:
>my_dna_sequence
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

3️⃣ Configure Parameters

  • 💡 FRAME: Select the reading frame(s) you want to translate. Options typically include: 1, 2, 3: Forward frames, -1, -2, -3: Reverse complement frames, All: Translate all six frames (recommended for initial exploration).
  • 📝 CODON TABLE: Choose the appropriate genetic code table for your organism. The "Standard" code is usually suitable for most common organisms.
  • 🔢 REGIONS: Define specific regions of your sequence to translate, but it fixed on OFF on the form.
  • ✂️ TRIM: Decide whether to trim the output sequence. (Options: "Yes," "No").
  • 🔄 REVERSE: Select "Yes" if you want to translate the reverse complement of your sequence. (Options: "Yes," "No").

4️⃣ Submit Your Job

  • Click Submit or Run.
  • You’ll be redirected to a Job Status page while your job is processed.

5️⃣ Interpret Results

  • View protein sequences for your selected frames.
  • Tip: Long stretches without * (stop codons) suggest protein-coding regions.

🧪 Example

Input (FASTA):

>example_dna
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

Partial Output (Reading Frame 1):

>example_dna_1
MAMALASLASLASLASLASLAM

💬 Help

If you run into issues, please visit our Contact Us page for support.