🔍 TBLASTX: Translated Nucleotide vs. Translated Nucleotide BLAST

TBLASTX (Basic Local Alignment Search Tool, Translated Nucleotide vs. Translated Nucleotide) is a powerful bioinformatics tool used to compare a translated nucleotide query sequence against a translated nucleotide sequence database. It translates both the query and all database sequences in all six possible reading frames before performing the search.

❓ What is TBLASTX?

TBLASTX is the most computationally intensive BLAST program because it performs a six-frame translation on both the query sequence and every sequence in the chosen nucleotide database. It then compares these translated protein sequences. This is ideal for finding very distant relationships between nucleotide sequences that might be missed by direct nucleotide or single-translated searches.

  • Translated Query vs. Translated Database: Translates both query and database sequences.
  • Six-Frame Translation (Both Sides): Accounts for all possible coding regions in both query and target.
  • High Sensitivity: Excellent for detecting distant homology between nucleotide sequences.

🎯 Why Use TBLASTX? For Distant Homology & Divergent Gene Discovery

TBLASTX is indispensable for:

  • 🔍 Distant Gene Discovery: Identifying highly divergent or distantly related genes in uncharacterized genomic or transcriptomic data.
  • 🧬 Ancient Homolog Detection: Finding very old evolutionary relationships between nucleotide sequences where direct sequence similarity is no longer apparent.
  • 📊 Pseudogene Identification: Distinguishing functional genes from highly diverged pseudogenes.
  • 🎯 Cross-Species Comparison: Uncovering subtle protein-level similarities between nucleotide sequences from very different organisms.
  • 📈 Comprehensive Coding Region Analysis: Ensuring all potential coding regions in both query and target are considered.

🧑‍💻 How to Use TBLASTX on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a translated nucleotide vs. translated nucleotide BLAST search:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "TBLASTX").
  2. Click the prominent Use Tool button located next to "TBLASTX."

2️⃣ Input Your Nucleotide Sequence

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your nucleotide (DNA or RNA) query sequence(s) in FASTA format or upload a FASTA file.

    >my_dna_query
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide a sequence either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My TBLASTX Search").

  • 💡 Sequence Type: (Automatically set to DNA for TBLASTX, as it expects nucleotide input).

  • 🗄️ Databases: Select one or more nucleotide databases to search against.

    • Default: em_est_env, em_gss_env, em_htc_env, em_htg_env, em_pat_env, em_std_env, em_sts_env, em_tsa_env
    • (Many other options available in the Nucleotide Databases Tree on the form)

  • ⚙️ TASK (task): Choose the specific BLAST task.

    • blastn - Default (This is the underlying task for TBLASTX)

  • 📝 INCL. TAXONOMY IDs (taxids): Enter taxonomy IDs separated by commas (e.g., 9606, 10090, 7227).

  • 📝 EXCL. TAXONOMY IDs (negative_taxids): Enter taxonomy IDs separated by commas (e.g., 9606, 10090, 7227).

  • 📊 Matrix (matrix): Select the scoring matrix to use for protein alignments (after translation).

    • BLOSUM62 - Default
    • BLOSUM45, BLOSUM50, BLOSUM80, BLOSUM90
    • PAM30, PAM70, PAM250
    • NONE (M10)

  • 📉 EXP.THR (exp): The Expectation Value (E-value) threshold. Matches with E-values higher than this will not be reported. Lower values are stricter.

    • Default: 10
    • Options: 1e-200, 1e-100, 1e-50, 1e-10, 1e-5, 1e-4, 0.001, 0.01, 0.1, 1.0, 10, 100, 1000, 20, 50

  • 🧹 FILTER (filter): Apply a low-complexity filter.

    • yes (T) - Default
    • no (F)

  • 🗑️ DROPOFF (dropoff): Dropoff value for the Gapped BLAST algorithm.

    • Default: 0
    • Options: 2, 4, 6, 8, 10

  • 🔢 SCORES (scores): Maximum number of scores to report.

    • Default: 50
    • Options: 0, 5, 10, 20, 50, 100, 150, 200, 250, 500, 750, 1000

  • ↔️ ALIGNMENTS (alignments): Maximum number of alignments to report.

    • Default: 50
    • Options: 0, 5, 10, 20, 50, 100, 150, 200, 250, 500, 750, 1000

  • 📏 SEQUENCE RANGE (seqrange): Define a specific range within the query sequence to search.

    • Default: START-END (entire sequence)

  • 🔢 HSPS (hsps): Maximum number of High-scoring Segment Pairs (HSPs) to report.

    • Default: 100
    • Input type: Number

  • ↔️ GAPALIGN (gapalign): Perform gapped alignments.

    • true - Default
    • false

  • 👁️ ALIGN VIEWS (align): Choose the format for displaying alignments.

    • 0 (pairwise) - Default
    • 1 (Query-anchored identities), 2 (Query-anchored non-identities), 3 (Flat query-anchored identities), 4 (Flat query-anchored non-identities)
    • 5 (BLASTXML), 6 (Tabular), 7 (Tabular with comment lines), 8 (Text ASN.1), 9 (Binary ASN.1), 10 (Comma-separated values), 11 (BLAST archive format (ASN.1)), 12 (Tabular with comment lines with btop)

  • 📏 WORD SIZE (wordsize): The length of the initial exact match (seed) required to initiate an alignment.

    • Default: 3
    • Input type: Number

  • 📚 TRANSLTION TABLE (transltable): Select the genetic code table for translating both query and database sequences.

    • Default: 1 (Standard SGC0)
    • Options: N/A (-1), 1 (Standard SGC0), 2 (Vertebrate Mitochondrial), 3 (Yeast Mitochondrial), ..., 23 (Thraustochytrium Mitochondrial)

4️⃣ Submit Your Job

  • Once your sequence is entered and parameters are set, click the Submit or Run button.
  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find a summary of your TBLASTX search, including a graphical overview of matches, a table of significant alignments, and detailed pairwise alignments.
  • Pay attention to the E-value, as TBLASTX is designed to find very distant homologs where sequence similarity might be low.
  • ⭐ Tip: TBLASTX is computationally intensive. Use it when other BLAST programs fail to find significant hits, suggesting very distant relationships.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy BLASTing!