🧬 MUSCLE: Multiple Sequence Alignment for Large Datasets

MUSCLE (Multiple Sequence Comparison by Log-Expectation) is a highly regarded and widely used software for creating multiple sequence alignments (MSAs). It's known for its excellent balance of speed and accuracy, particularly effective for aligning large numbers of protein or nucleic acid sequences.

❓ What is MUSCLE?

MUSCLE is an iterative algorithm that builds multiple sequence alignments. It starts with a fast progressive alignment, then refines it through several iterations to improve accuracy. This makes it a robust choice for diverse biological sequence analysis tasks, from small sets to very large datasets.

  • Speed & Accuracy: Achieves high alignment quality in a reasonable time.

  • Scalability: Efficiently handles large numbers of sequences, making it suitable for genomic and proteomic studies.

  • Versatile Input: Primarily used for protein sequences, but also supports nucleic acid alignments.

🎯 Why Use MUSCLE? A Go-To for Reliable Alignments

MUSCLE is an indispensable tool for:

  • 🔍 Phylogenetic Tree Construction: Generating accurate multiple sequence alignments, which are fundamental for inferring evolutionary relationships.

  • 🧬 Conserved Region Identification: Pinpointing highly conserved amino acid or nucleotide regions, crucial for understanding functional sites and structural motifs.

  • 📊 Protein Family Analysis: Classifying and analyzing protein families based on their sequence similarities.

  • 🎯 Primer Design: Informing the design of primers for PCR and other molecular biology experiments.

  • 📈 Functional Inference: Aiding in the prediction of protein function by aligning sequences with characterized homologs.

🧑‍💻 How to Use MUSCLE on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a multiple sequence alignment with MUSCLE:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "Muscle").

  2. Click the prominent Use Tool button located next to "Muscle."

2️⃣ Input Your Sequences

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your sequences in FASTA format or upload a FASTA file. MUSCLE primarily supports protein sequences, but can also handle nucleic acids.

    >protein_A
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>protein_B
ATGGCCATGGCAC-TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>protein_C
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My MUSCLE Alignment").

  • 💡 Sequence Type: Select the type of sequence you are submitting:

    • Protein (Primary type for MUSCLE)
    • DNA
    • RNA

  • ⚙️ OUTPUT FORMAT (format): Choose the desired output format for your alignment results.

    • fasta (Pearson/FASTA)
    • clw (ClustalW) - Default
    • clwstrict (ClustalW (strict))
    • html (HTML)
    • msf (GCG MSF)
    • phyi (Phylip interleaved)
    • phys (Phylip sequential)

4️⃣ Submit Your Job

  • Once your sequences are entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find your multiple sequence alignment in the chosen output format.
  • Look for conserved residues, gaps, and insertions, which provide insights into functional and evolutionary relationships.
  • ⭐ Tip: For very large alignments, consider using a dedicated alignment viewer (like Mview, if available on Job Dispatcher) for better visualization and analysis.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support.