📊 EMBOSS Sixpack: Six-Frame Translation & ORF Analysis

EMBOSS Sixpack is a bioinformatics tool that performs a six-frame translation of a nucleic acid sequence (DNA or RNA) and identifies potential Open Reading Frames (ORFs). It's a fundamental tool for exploring the protein-coding potential of a given DNA or RNA sequence.

❓ What is EMBOSS Sixpack?

Sixpack takes a nucleotide sequence and translates it into all six possible reading frames: three in the forward direction and three in the reverse complement direction. For each frame, it identifies ORFs, which are stretches of codons starting with a start codon and ending with a stop codon. This helps in quickly visualizing and analyzing all potential protein products.

  • Six-Frame Translation: Translates nucleotide sequence in all possible reading frames.
  • ORF Identification: Highlights potential Open Reading Frames (ORFs).
  • Comprehensive Overview: Provides a complete view of protein-coding potential.

🎯 Why Use Sixpack? For Gene & Protein Discovery

EMBOSS Sixpack is indispensable for:

  • 🔍 Initial Gene Discovery: Quickly scanning a new DNA sequence for any potential protein-coding regions.
  • 🧬 ORF Analysis: Identifying and characterizing all possible Open Reading Frames.
  • 📊 Protein Product Exploration: Understanding the full range of protein sequences that could be encoded by a given DNA/RNA.
  • 🎯 Primer Design: Locating regions suitable for primer design within or flanking ORFs.
  • 📈 Sequence Annotation: Aiding in the annotation process by revealing coding regions and their translations.

🧑‍💻 How to Use EMBOSS Sixpack on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a six-frame translation and ORF analysis with Sixpack:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "EMBOSS Sixpack").
  2. Click the prominent Use Tool button located next to "EMBOSS Sixpack."

2️⃣ Input Your Nucleic Acid Sequence

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your nucleic acid (DNA/RNA) sequence in FASTA format or upload a FASTA file.

    >my_dna_sequence
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide a sequence either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My Six-Frame Analysis").

  • 💡 Sequence Type: (Automatically set to DNA, as this tool primarily processes DNA/RNA sequences).

  • 📚 CODON TABLE (codontable): Select the genetic code table to use for translation.

    • 0 (Standard Code) - Default
    • 2 (Vertebrate Mitochondrial)
    • 3 (Yeast Mitochondrial)
    • 4 (Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma)
    • (...and many more options available, see form for full list)

  • ➡️ FIRST ORF (firstorf): Report only the first ORF found in each frame.

    • yes - Default
    • no

  • ⬅️ LAST ORF (lastorf): Report only the last ORF found in each frame.

    • true - Default
    • false

  • 🔄 REVERSE (reverse): Include translation of the reverse complement strand.

    • true - Default
    • false

  • 📏 ORF MINIMUM SIZE (orfminsize): Minimum size (in amino acids) for an ORF to be reported.

    • Default: 1
    • Input type: Number

4️⃣ Submit Your Job

  • Once your sequence is entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will see the translated protein sequences for all six reading frames, with identified ORFs clearly marked.
  • The output typically includes the original nucleotide sequence, its reverse complement, and the translated protein sequences for each frame, often with stop codons indicated.
  • ⭐ Tip: Look for long ORFs without internal stop codons, as these are strong candidates for actual protein-coding genes.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy analyzing!