🧬 MUSCLE 5: Next-Generation Multiple Sequence Alignment

MUSCLE 5 is the latest iteration of the highly regarded MUSCLE (Multiple Sequence Comparison by Log-Expectation) software. It builds upon its predecessor's strengths, offering even faster and more accurate multiple sequence alignments (MSAs), particularly optimized for handling extremely large datasets of protein or nucleic acid sequences.

❓ What is MUSCLE 5?

MUSCLE 5 features algorithmic advancements that improve its performance and accuracy over previous versions, especially when dealing with massive numbers of sequences. It maintains the iterative refinement approach, ensuring high-quality alignments while pushing the boundaries of scalability.

  • Enhanced Speed & Accuracy: Delivers superior alignment quality and speed for demanding tasks.

  • Extreme Scalability: Designed to efficiently align even larger datasets than previous versions.

  • Versatile Input: Supports both protein and nucleic acid sequences.

🎯 Why Use MUSCLE 5? The Evolution of Reliable Alignments

MUSCLE 5 is an indispensable tool for:

  • 🔍 Large-Scale Phylogenetic Analysis: Generating highly accurate multiple sequence alignments, which are fundamental for inferring evolutionary relationships across vast datasets.

  • 🧬 Advanced Conserved Motif Discovery: Pinpointing highly conserved amino acid or nucleotide regions with greater precision, crucial for understanding functional sites and structural motifs.

  • 📊 High-Throughput Protein/Gene Family Analysis: Efficiently classifying and analyzing extensive protein or gene families based on their sequence similarities.

  • 🎯 Optimized Primer Design: Informing the design of highly specific primers for PCR and other molecular biology experiments from large alignments.

  • 📈 Refined Functional Inference: Aiding in more precise prediction of protein function by aligning sequences with characterized homologs.

🧑‍💻 How to Use MUSCLE 5 on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a multiple sequence alignment with MUSCLE 5:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "Muscle 5").

  2. Click the prominent Use Tool button located next to "Muscle 5."

2️⃣ Input Your Sequences

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your sequences in FASTA format or upload a FASTA file. MUSCLE 5 primarily supports protein sequences, but can also handle nucleic acids.

    >protein_X
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>protein_Y
ATGGCCATGGCAC-TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG
>protein_Z
ATGGCTATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide sequences either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My MUSCLE 5 Alignment").

  • 💡 Sequence Type: Select the type of sequence you are submitting:

    • Protein (Primary type for MUSCLE 5)
    • DNA
    • RNA

  • ⚙️ OUTPUT FORMAT (format): Choose the desired output format for your alignment results.

    • fasta (Pearson/FASTA)
    • clw (ClustalW) - Default
    • clwstrict (ClustalW (strict))
    • html (HTML)
    • msf (GCG MSF)
    • phyi (Phylip interleaved)
    • phys (Phylip sequential)

4️⃣ Submit Your Job

  • Once your sequences are entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find your multiple sequence alignment in the chosen output format.
  • Look for conserved residues, gaps, and insertions, which provide insights into functional and evolutionary relationships.
  • ⭐ Tip: For very large alignments, consider using a dedicated alignment viewer (like Mview, if available on Job Dispatcher) for better visualization and analysis.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy analyzing!