📊 EMBOSS Isochore: Analyzing Genomic G+C Content Variation

EMBOSS Isochore is a bioinformatics tool used to identify and visualize isochores within a large nucleic acid sequence, typically genomic DNA. Isochores are long stretches of DNA (hundreds of kilobases to megabases) that are relatively homogeneous in their guanine (G) and cytosine (C) content, but differ significantly from neighboring regions.

❓ What is EMBOSS Isochore?

Isochore scans a long DNA sequence using a sliding window approach to calculate the G+C content. It then generates a plot that shows the variation in G+C content along the sequence, helping to identify distinct isochore regions. These regions often correlate with gene density and replication timing.

  • G+C Content Analysis: Calculates and plots G+C content variation.

  • Isochore Identification: Helps delineate regions of homogeneous G+C composition.

  • Genomic Insights: Provides clues about gene density and replication patterns.

🎯 Why Use Isochore? For Genomic Structure & Evolution

EMBOSS Isochore is indispensable for:

  • 🔍 Genomic Organization: Understanding the large-scale compositional heterogeneity of a genome.

  • 🧬 Gene Density Prediction: Isochore boundaries often correlate with changes in gene density.

  • 📊 Evolutionary Studies: Analyzing the evolutionary history of genomes, as isochores can be conserved across species.

  • 📈 Replication Timing: G+C-rich isochores are often associated with early-replicating regions.

  • 🎯 Genome Annotation: Aiding in the annotation of large genomic regions by identifying distinct compositional segments.

🧑‍💻 How to Use EMBOSS Isochore on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to analyze your nucleic acid sequence for isochores with Isochore:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "EMBOSS Isochore").

  2. Click the prominent Use Tool button located next to "EMBOSS Isochore."

2️⃣ Input Your Nucleic Acid Sequence

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your long nucleic acid (DNA) sequence in FASTA format or upload a FASTA file. Isochore is typically used for genomic-scale sequences.

    >my_dna_query
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide a sequence either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My Isochore Analysis").

  • 💡 Sequence Type: (Automatically set to DNA for Isochore, as it expects nucleic acid input).

  • 📏 WINDOW SIZE (window): Input your own value for the size of the sliding window used to calculate G+C content.

    • Default: 1000
    • Input type: Number

  • 📏 SHIFT INCREMENT (shift): Input your own value for how much the window shifts along the sequence.

    • Default: 100
    • Input type: Number

4️⃣ Submit Your Job

  • Once your sequence is entered and parameters are set, click the Submit or Run button.

  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find a plot showing the G+C content variation along your sequence, highlighting isochore regions.
  • The output typically includes a graph and a report detailing the G+C content in each window.
  • ⭐ Tip: Look for plateaus or distinct shifts in the G+C content plot, as these indicate the boundaries of isochores.

💬 Need Help?

If you run into issues, please visit our Contact Us page for dedicated support. Happy analyzing!