🔍 BLASTN: Nucleotide-Nucleotide BLAST

BLASTN (Basic Local Alignment Search Tool for Nucleotides) is a fundamental bioinformatics tool used to compare a nucleotide (DNA or RNA) query sequence against a nucleotide sequence database. It identifies regions of local similarity between nucleic acid sequences, helping to infer functional and evolutionary relationships.

❓ What is BLASTN?

BLASTN takes a DNA or RNA query sequence and searches it directly against a chosen nucleotide sequence database. It identifies regions of significant similarity, providing a list of hits (matching sequences) and their alignments. This is the most common BLAST program for direct nucleotide sequence comparison.

  • Nucleotide Query vs. Nucleotide Database: Compares nucleotide to nucleotide.
  • Local Alignment: Finds regions of highest similarity.
  • Homology Inference: Helps deduce function and evolutionary relationships for nucleic acids.

🎯 Why Use BLASTN? For DNA/RNA Homology & Gene Identification

BLASTN is indispensable for:

  • 🔍 Gene Identification: Finding known genes or homologous sequences in a newly sequenced genome or transcript.
  • 🧬 Primer/Probe Specificity: Checking the specificity of PCR primers or hybridization probes against a genome or transcript database.
  • 📊 Sequence Verification: Confirming the identity of a cloned DNA fragment.
  • 🎯 SNP/Variant Detection: Identifying single nucleotide polymorphisms (SNPs) or other small variants when comparing a query to a reference.
  • 📈 Contamination Detection: Identifying contaminating sequences in your sample.

🧑‍💻 How to Use BLASTN on Job Dispatcher: A Step-by-Step Guide

Follow these simple steps to perform a nucleotide-nucleotide BLAST search:

1️⃣ Navigate to the Tool

  1. From the main menu, go to All Tools (or search for "BLASTN").
  2. Click the prominent Use Tool button located next to "BLASTN."

2️⃣ Input Your Nucleotide Sequence

  • Locate the input box (large text area) or the "upload a Sequence File" option.

  • Paste your nucleotide (DNA or RNA) sequence(s) in FASTA format or upload a FASTA file.

    >my_dna_query
ATGGCCATGGCACTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATG

  • Important: You can provide a sequence either by typing into the text area OR by uploading a file, but not both simultaneously. Please clear one input to proceed.

3️⃣ Configure Parameters

  • 📝 Title: Provide a descriptive title for your job (e.g., "My BLASTN Search").

  • 💡 Sequence Type: (Automatically set to DNA for BLASTN, as it expects nucleotide input).

  • 🗄️ Databases: Select one or more nucleotide databases to search against.

    • Default: em_est_env, em_gss_env, em_htc_env, em_htg_env, em_pat_env, em_std_env, em_sts_env, em_tsa_env
    • (Many other options available in the Nucleotide Databases Tree on the form)

  • ⚙️ TASK (task): Choose the specific BLASTN task.

    • blastn - Default (Standard nucleotide-nucleotide BLAST)
    • megablast (Optimized for highly similar sequences, faster)

  • 📝 INCL. TAXONOMY IDs (taxids): Enter taxonomy IDs separated by commas (e.g., 9606, 10090, 7227).

  • 📝 EXCL. TAXONOMY IDs (negative_taxids): Enter taxonomy IDs separated by commas (e.g., 9606, 10090, 7227).

  • ➕ MATCH/MISMATCH SCORES (match_scores): Define scores for matches and mismatches.

    • Default: 1,-3
    • Options: 1,-4, 2,-7, 1,-3, 2,-5, 1,-2, 2,-3, 1,-1, 5,-4, 4,-5

  • ➖ Gap Open (gapopen): The penalty for opening a new gap.

    • Default: 5
    • Options: -1, 0, 1, ..., 25

  • ➖ Gap Extend (gapext): The penalty for extending an existing gap.

    • Default: 2
    • Options: -1, 0, 1, ..., 10

  • 📉 EXP.THR (exp): The Expectation Value (E-value) threshold. Matches with E-values higher than this will not be reported. Lower values are stricter.

    • Default: 10
    • Options: 1e-200, 1e-100, 1e-50, 1e-10, 1e-5, 1e-4, 0.001, 0.01, 0.1, 1.0, 10, 100, 1000, 20, 50

  • 🧹 FILTER (filter): Apply a low-complexity filter (e.g., DUST filter for nucleotide).

    • yes (T) - Default
    • no (F)

  • 🗑️ DROPOFF (dropoff): Dropoff value for the Gapped BLAST algorithm.

    • Default: 0
    • Options: 2, 4, 6, 8, 10

  • 🔢 SCORES (scores): Maximum number of scores to report.

    • Default: 50
    • Options: 0, 5, 10, 20, 50, 100, 150, 200, 250, 500, 750, 1000

  • ↔️ ALIGNMENTS (alignments): Maximum number of alignments to report.

    • Default: 50
    • Options: 0, 5, 10, 20, 50, 100, 150, 200, 250, 500, 750, 1000

  • 📏 SEQUENCE RANGE (seqrange): Define a specific range within the query sequence to search.

    • Default: START-END (entire sequence)

  • 🔢 HSPS (hsps): Maximum number of High-scoring Segment Pairs (HSPs) to report.

    • Default: 100
    • Input type: Number

  • ↔️ GAPALIGN (gapalign): Perform gapped alignments.

    • true - Default
    • false

  • 👁️ ALIGN VIEWS (align): Choose the format for displaying alignments.

    • 0 (pairwise) - Default
    • 1 (Query-anchored identities), 2 (Query-anchored non-identities), 3 (Flat query-anchored identities), 4 (Flat query-anchored non-identities)
    • 5 (BLASTXML), 6 (Tabular), 7 (Tabular with comment lines), 8 (Text ASN.1), 9 (Binary ASN.1), 10 (Comma-separated values), 11 (BLAST archive format (ASN.1)), 12 (Tabular with comment lines with btop)

  • 📏 WORD SIZE (wordsize): The length of the initial exact match (seed) required to initiate an alignment.

    • Default: 11
    • Input type: Number

4️⃣ Submit Your Job

  • Once your sequence is entered and parameters are set, click the Submit or Run button.
  • Your job will be dispatched to the EMBL-EBI Web Service. You will be automatically redirected to a Job Status page to monitor its progress.

5️⃣ Interpret Results

  • On the results page, you will find a summary of your BLASTN search, including a graphical overview of matches, a table of significant alignments, and detailed pairwise alignments.
  • Pay attention to the E-value (Expectation Value), which indicates the number of hits you would expect to see by chance. Lower E-values mean more significant matches.
  • ⭐ Tip: For very similar sequences, consider using the megablast task for faster results.

💬 Need Help?

If you run into issues, please visit our Contact Us page for support. Happy BLASTing!